View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17373_high_27 (Length: 201)
Name: NF17373_high_27
Description: NF17373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17373_high_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 4075370 - 4075562
Alignment:
| Q |
1 |
atggatggccttcttttctgtactctgatagctgtgtgatgttaagcaattgaacattcaaacctctagttttcaaatcttctagaacattttcaaccac |
100 |
Q |
| |
|
||||||| |||||||||||||||||||| || ||||| ||||||||||||||||||||||||||||| |||||||||||| |||||||||||| ||||| |
|
|
| T |
4075370 |
atggatgaccttcttttctgtactctgagagttgtgttatgttaagcaattgaacattcaaacctcttcttttcaaatcttgtagaacattttccaccac |
4075469 |
T |
|
| Q |
101 |
ttgcatcattttaggaacagaaccatttccactatatccatcttctgtaatttgatctctttctttgtaacaattttcaccctttgcttctcc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4075470 |
ttgcatcattttaggaacagaaccatttccactatatccctcttctttaatttgatctctttctttgtaacaattttcaccctttgctcctcc |
4075562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 9 - 115
Target Start/End: Complemental strand, 25824782 - 25824676
Alignment:
| Q |
9 |
ccttcttttctgtactctgatagctgtgtgatgttaagcaattgaacattcaaacctctagttttcaaatcttctagaacattttcaaccacttgcatca |
108 |
Q |
| |
|
|||||||||||||| ||||| || |||||||||||||||| ||||||||| |||||| | ||||||||||| || || || || || ||||||||||||| |
|
|
| T |
25824782 |
ccttcttttctgtattctgagagttgtgtgatgttaagcatttgaacatttaaaccttttgttttcaaatcatcaagcaccttctccaccacttgcatca |
25824683 |
T |
|
| Q |
109 |
ttttagg |
115 |
Q |
| |
|
||||||| |
|
|
| T |
25824682 |
ttttagg |
25824676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University