View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17373_low_21 (Length: 314)
Name: NF17373_low_21
Description: NF17373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17373_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 20 - 305
Target Start/End: Original strand, 4885053 - 4885338
Alignment:
| Q |
20 |
acttctactgttgtttgttaatattctctcgttttgttcttttcttttctttcttaccgacgagtttttgctatgacggtgattatttttatccggtggt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4885053 |
acttctactgttgtttgttaatattctctcgttttgttcttttcttttctttcttaccgacgagtttttgctatgacggtgattatttttatccggtggt |
4885152 |
T |
|
| Q |
120 |
ggcggtgtagggagaggcatgaggaagtaaatcttaccgcgttgaagatcagcatcgggagggacaacaacgatcttaggaacaactccgccatcttgtg |
219 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4885153 |
ggcggcgtagggagaggcatgaggaagtaaatcttaccgcgttgaagatcagcatcgggagggacaacaacgatcttaggaacaacaccgccatcttgtg |
4885252 |
T |
|
| Q |
220 |
ttgaaggtgaagaaggtttcttgagaacatgttttgggtatgttttcatgatttcacttgctttgatgctgccactgatttcttct |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4885253 |
ttgaaggtgaagaaggtttcttgagaacatgttttgggtatgttttcatgatttcacttgctttgatgctgccactgatttcttct |
4885338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University