View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17374_low_10 (Length: 236)
Name: NF17374_low_10
Description: NF17374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17374_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 4 - 210
Target Start/End: Complemental strand, 20542991 - 20542785
Alignment:
| Q |
4 |
atataattgttagtattatttctccaagtaagtaaattatttttaattgcatattgaaatttctccttctaaaactaagnnnnnnnnnnnnnnnnnnaat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
20542991 |
atataattgttagtattatttctccaagta-gtaaattatttttaattgcagattgaaatttctccttctaaaactaagttttatttttttatttttaat |
20542893 |
T |
 |
| Q |
104 |
tatagaaaattaaagaaaggaaaactatctagaagagggaggatggtctccgtt-aatggagcttcaaaattttatagaattgttgaaaatataataatt |
202 |
Q |
| |
|
||| |||||||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20542892 |
tatggaaaattaaagaaaggaaaactgtctagaagagggaggatggtctccctttaatggagcttcaaaattttatagaattgttgaaaatataataatt |
20542793 |
T |
 |
| Q |
203 |
caaagtca |
210 |
Q |
| |
|
|||||||| |
|
|
| T |
20542792 |
caaagtca |
20542785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University