View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17374_low_11 (Length: 228)
Name: NF17374_low_11
Description: NF17374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17374_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 31326505 - 31326295
Alignment:
| Q |
1 |
caattaacatgtggtgatagtgagctcaatttgtaccttgcagatatttcaccaagtttcttcctcctacctgaaaaaaccaaatagattaattcttcgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
31326505 |
caattaacatgtggtgatagtgagctcaatttgtaccttgcagatatttcaccaagtttcttcctcctacctgaaaaaaccaaatagatcaattcttcat |
31326406 |
T |
 |
| Q |
101 |
gtatgatcacttgattttgcttaaggatcatatagcaaaataacacgtaagaaacaa--agagtttcataatttgtgaatttggacaacatagtagtagt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31326405 |
gtatgatcacttgattttgcttaaggatcatatagcaaaataacacgtaagaaacaaagagagtttcataatttgtgaatttggacaacatattagtagt |
31326306 |
T |
 |
| Q |
199 |
acatgccagta |
209 |
Q |
| |
|
||||||||||| |
|
|
| T |
31326305 |
acatgccagta |
31326295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University