View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17374_low_8 (Length: 270)
Name: NF17374_low_8
Description: NF17374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17374_low_8 |
 | |
|
| [»] scaffold0141 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0141 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: scaffold0141
Description:
Target: scaffold0141; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 161 - 256
Target Start/End: Complemental strand, 6329 - 6234
Alignment:
| Q |
161 |
agattctatggatgctgatctgtctctttattggaccaaagagtggctctccgcggagttcgttccgatgcctgtcgtgccttgcaagattgagat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6329 |
agattctatggatgctgatctgtctctttattggaccaaagagtggctctccgcggagttcgttccgatgcctgtcgtgccttgcaagattgagat |
6234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 96; Significance: 4e-47; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 141 - 256
Target Start/End: Original strand, 49237921 - 49238036
Alignment:
| Q |
141 |
cagactgcctctttctagatagattctatggatgctgatctgtctctttattggaccaaagagtggctctccgcggagttcgttccgatgcctgtcgtgc |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| | |
|
|
| T |
49237921 |
cagactgcctatttctagatagattctatggatgatgatctgtctctttattggaccaaagagtggctctccgcggagttcgttccaatgcatgtcgtac |
49238020 |
T |
|
| Q |
241 |
cttgcaagattgagat |
256 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
49238021 |
cttgcaagattgagat |
49238036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 44285697 - 44285603
Alignment:
| Q |
1 |
gaaatgcagacttcgctccgcacctttaggtaaagatccccattgtccaatcttcctttaatggatatattcttaaatgtaacttccggtaagaa |
95 |
Q |
| |
|
||||||| || || |||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44285697 |
gaaatgccgaatttgctccgcatcgttaggtaaagatccccattggccaatcttcctttaatggatatattcttcaatgtaacttccggtaagaa |
44285603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 44070316 - 44070410
Alignment:
| Q |
1 |
gaaatgcagacttcgctccgcacctttaggtaaagatccccattgtccaatcttcctttaatggatatattcttaaatgtaacttccggtaagaa |
95 |
Q |
| |
|
||||||| || ||||||||||| | ||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
44070316 |
gaaatgccgaattcgctccgcattgtaaggtaaagatctccattgtccaatcttgctttaatggatatattcttcaatgtaacttctggtaagaa |
44070410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University