View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17374_low_9 (Length: 260)
Name: NF17374_low_9
Description: NF17374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17374_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 15 - 198
Target Start/End: Original strand, 27404032 - 27404215
Alignment:
| Q |
15 |
tatcttaacttccattacggctgttaactaccactcgttaaatctttccacaatagtttactgctgttgcgttcttgcttataccaaaacaaaacaaaat |
114 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27404032 |
tatcttaacttccattacggctgttaagtaccgctcgttaaatctttccacaatagtttactgctgttgcgttcttgcttataccaaaacaaaacaaaat |
27404131 |
T |
|
| Q |
115 |
ttaaccattatttacgaaagtacatagagtacaaatctctctctcccacaaaccaatttcctcaacttcaagcaaatcaacttg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27404132 |
ttaaccattatttacgaaagtacatagagtacaaatctctctctcccacaaaccaatttcctcaacttcaaacaaatcaacttg |
27404215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 39 - 165
Target Start/End: Original strand, 18034414 - 18034541
Alignment:
| Q |
39 |
taactaccactcgttaaatctttccacaatagtttactgctgttgcgttcttgcttataccaaaacaa-aacaaaatttaaccattatttacgaaagtac |
137 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||| ||||||||||| || ||||||| || || ||||||| || |||||||||||||||| || |
|
|
| T |
18034414 |
taactaccgctcgttaaatctttccgtggcagtttactattgttgcgttctggcctataccagaataacaacaaaaattgaccattatttacgaaatcac |
18034513 |
T |
|
| Q |
138 |
atagagtacaaatctctctctcccacaa |
165 |
Q |
| |
|
||||||||| |||||||||||||||||| |
|
|
| T |
18034514 |
atagagtacgaatctctctctcccacaa |
18034541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Original strand, 3554312 - 3554348
Alignment:
| Q |
157 |
ctcccacaaaccaatttcctcaacttcaagcaaatca |
193 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
3554312 |
ctcccacaaaccaatttcttcaacttcaagtaaatca |
3554348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University