View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17376_low_4 (Length: 325)
Name: NF17376_low_4
Description: NF17376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17376_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 35 - 309
Target Start/End: Complemental strand, 10443745 - 10443471
Alignment:
| Q |
35 |
tattaacacacaaatgaataaatgtactcacactaaatttaaatatgtaccaatagttatcataatattttaatgttagtttccacaatttgaggaatca |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10443745 |
tattaacacacaaatgaataaatgtactcacactaaatttaaatatgtaccaatagttatcataatattttagtgttagtttccacaatttgaggaatca |
10443646 |
T |
 |
| Q |
135 |
tctggcggttatatttttccgttgtttaaatagcctttctactcataaggcaaggctatgtacgtctaactgtcctcaaaccccatggtgggaacctcaa |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10443645 |
tctggcggttatatttttccgttgtttaaatagcctttctactcataaggcaaggctatgtacgtctaactgtcctcaaaccccatggtgggagcctcaa |
10443546 |
T |
 |
| Q |
235 |
gcatggagccacccttctttagttaacacacaagcattgaaatttatccttattggcaatggtaatgtgtttagt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10443545 |
gcatggagccacccttctttagttaacacacaagcattgaaatttatcctaattggcaatggtaatgtgtttagt |
10443471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University