View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17377_low_7 (Length: 273)
Name: NF17377_low_7
Description: NF17377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17377_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 46 - 265
Target Start/End: Complemental strand, 30222420 - 30222196
Alignment:
| Q |
46 |
ggtgacattatcagtcaactcaatatgatctgatcatcccatc-----agtctacatctttggaacttcatttcttctttcttcaacatctcaaacacaa |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30222420 |
ggtgacattatcagtcaactcaatatgatctgatcatcccatcccatcagtctacatctttggaacttcatttcttctttcttcaacatctcaaacacaa |
30222321 |
T |
 |
| Q |
141 |
acacactaaccatgtctttgtttagaaacctctcaaaaagttacttcttcaccacgaaacaacttttcaaaccccccaactcaaccaacccttctcacct |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30222320 |
acacactaaccatgtctttgtttagaaacctctcaaaaagttacttcttcaccacgaaacaacttttcaaaccccccaactcaaccaacccttctcacct |
30222221 |
T |
 |
| Q |
241 |
cttcccatctctcactcttctctct |
265 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
30222220 |
cttcccatctctcactcttctctct |
30222196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University