View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17378_high_1 (Length: 307)
Name: NF17378_high_1
Description: NF17378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17378_high_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 9 - 158
Target Start/End: Complemental strand, 4319775 - 4319626
Alignment:
| Q |
9 |
taatactctcatttgttttgtttgcagaaaataatgaatgttcaatactccatacctgactatgtgcacatatctgcagattgtagggaacttatctctc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4319775 |
taatactctcatttgttttgtttgcagaaaataatgaatgttcaatactccatacctgactatgtgcacatatctgcagattgtagggaacttatctctc |
4319676 |
T |
|
| Q |
109 |
gtatttttgttgccaatccagctaaggtaaatattagtcttaattctctc |
158 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
4319675 |
gtatttttgttgccaatccagcttaggtaaatattagtcttaactctctc |
4319626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 176 - 291
Target Start/End: Complemental strand, 4319526 - 4319411
Alignment:
| Q |
176 |
gaatttagacgatgaaaaaagtggaagattgaaaatatttaataaaaggaaaaatggctcatcttacggaatgaaactattcgggtgcagtcgtgcttgt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4319526 |
gaatttagacgatgaaaaaagtggaagattgaaaatatttaataaaaggaaaaatggctcatcttacggaatgaaactattagggtgcagtcgtgcttgt |
4319427 |
T |
|
| Q |
276 |
tggtctttgtaccaac |
291 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
4319426 |
tggtcttcgtaccaac |
4319411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University