View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17378_high_3 (Length: 246)
Name: NF17378_high_3
Description: NF17378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17378_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 230
Target Start/End: Complemental strand, 7417121 - 7416908
Alignment:
| Q |
17 |
tgtgccgagcttgatccagacaaaatttatctttttgattctggagcccaggtctgtctagtttacgttattgaaaattgctgaagcctgtagagattgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7417121 |
tgtgccgagcttgatccagacaaaatttatctttttgattctggagcccaggtctgtctagtttacgttattgaaaattgctgaagcctgtagagattgt |
7417022 |
T |
|
| Q |
117 |
taatactagtgaaacttactcttttggtgtatgatatccagttttgtatattgataatttgttgtgtgtttgtagtatctggatgggacaactgatatta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7417021 |
taatactagtgaaacttactcttttggtgtatgatatccagttttgtatattgataatttgttgtgtgtttgtagtatctggatgggacaactgatatta |
7416922 |
T |
|
| Q |
217 |
cacgaacagttcat |
230 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7416921 |
cacgaacagttcat |
7416908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University