View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17378_low_2 (Length: 256)
Name: NF17378_low_2
Description: NF17378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17378_low_2 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 58 - 256
Target Start/End: Complemental strand, 41953572 - 41953374
Alignment:
| Q |
58 |
gaatggccatgagcttctagaatgacatcaatcattcataatgttttaaaatggttttcaaatacggattcaacgtttaccaccatctatcaaagtggtt |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41953572 |
gaatggccatgagcttctagaatgacatcaatcattcttaatgttttaaaatggttttcaaatacggattcaacgtttaccaccatctatcaaagtggtt |
41953473 |
T |
|
| Q |
158 |
ccccttaaaatttgtatgtatatcaaattacacgcccctaaataacccctactaattccacaggttatgaaaaagtttttgtagttaaataggacagta |
256 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41953472 |
ccccttaaaatttgtatgtatatcacattacacgcccctaaataacccctactaattccacaggttatgaaaaagtttttgtagttaaataggacagta |
41953374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University