View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17380_high_11 (Length: 576)
Name: NF17380_high_11
Description: NF17380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17380_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 485; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 485; E-Value: 0
Query Start/End: Original strand, 10 - 514
Target Start/End: Complemental strand, 7430744 - 7430240
Alignment:
| Q |
10 |
ataatactctgttatatcattcagtccagttcttcctcaaatctcaaccatcacattcatatttcatccaccaccacgcgctactcaattctcacgcgcc |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7430744 |
ataatattctgttatatcattcagtccagttcttcctcaaatctcaaccatcacattcacatttcctccaccaccacgcgctactcaattctcacgcgcc |
7430645 |
T |
|
| Q |
110 |
tccgatcaaaaccaatgcgccaccactgatgcgcatggagataacaccaacaaccttcgcatcccacagttactccgaccttccctccgccgcatccatg |
209 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7430644 |
tccgattaaaaccaatgcgccaccactgatgcgcatggagataacaccaacaaccttcgcatcccacagttactccgaccttccctccgccgcatccatg |
7430545 |
T |
|
| Q |
210 |
ccgactcgtcctatcagagttatccctatgcaacatccaaaccttacgtctccatcttcttcgaattcgttacctccgaatgtcgcgattacgcagttcg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7430544 |
ccgactcgtcctatcagagttatccctatgcaacatccaaaccttacgtctccatcttcttcgaattcgttacctccgaatgtcgcgattacgcagttcg |
7430445 |
T |
|
| Q |
310 |
cgtcgaagcttcgaggaatgacgtggcttgaatggattgagttcttgattccttgttatcgttggattcggatatataaatggcgtgagtatcttcaggt |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7430444 |
cgtcgaagcttcgaggaatgacgtggcttgaatggattgagttcttgattccttgttatcgttggattcggatatataaatggcgtgagtatcttcaggt |
7430345 |
T |
|
| Q |
410 |
tgatcttatggctggaatcaccgttggtgttatgctcgttcctcaggtaacgtttcttctccgtttcgttgctgagaaaatgatagaaaaatgtttccat |
509 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7430344 |
tgatcttatggctggaatcaccgttggtgttatgctcgttcctcaggtaacgcttcttctccgtttcgttgctgagaaaatgatagaaaaatgtttccat |
7430245 |
T |
|
| Q |
510 |
tttcg |
514 |
Q |
| |
|
||||| |
|
|
| T |
7430244 |
tttcg |
7430240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University