View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17380_high_14 (Length: 551)
Name: NF17380_high_14
Description: NF17380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17380_high_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 6e-94; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 6e-94
Query Start/End: Original strand, 26 - 200
Target Start/End: Complemental strand, 33213767 - 33213593
Alignment:
| Q |
26 |
gttaagcaaggaatcgtaggaaagtgattgaacaaacagtgtcttttgaaaagccaaattttcatgcggttgggaaaatactgacaacaaagaaaaatta |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33213767 |
gttaagcaaggaatcgtaggaaagtgattgaacaaacagtgtcttttgaaaagccaaattttcatgcggttgggaaaatactgacaacaaagaaaaatta |
33213668 |
T |
|
| Q |
126 |
tttttaccaacaaaaaagattgtcgtagatttattattagctcttcgtacgttggttttgtttggactcattggg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33213667 |
tttttaccaacaaaaaagattgtcgtagatttattattagctcttcgtacgttggttttgtttggactcattggg |
33213593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 316 - 544
Target Start/End: Complemental strand, 33213477 - 33213251
Alignment:
| Q |
316 |
tttggggagtgaaaaggatatgacacttgaactcgtgtttgtagtacttcatggcatgtagtattattggtttgtacatccctaactcattcatctttgt |
415 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33213477 |
tttggggagtgaaaaggatatgacacttgaactcgtgtttgta---cttcatggcatgtagtattattggtttgtatatccctaactcattcatctttgt |
33213381 |
T |
|
| Q |
416 |
ggattgtgtattttagccttaataaagaacaccacgtttggtctcatagctcaactaaca-aaaatgacgaatgtcatgatcggattcgaacttcggtat |
514 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||| || ||||| |
|
|
| T |
33213380 |
ggattgtgtattttagccttaataaagaacaccatgtttggtctcatagctcaactaacaaaaaatgatgaatgtcatgatcgggttcgaattttggtat |
33213281 |
T |
|
| Q |
515 |
tttcacttgagtgtgtgagttgatgatgtc |
544 |
Q |
| |
|
| || |||||||||| |||| |||||||| |
|
|
| T |
33213280 |
ctccatttgagtgtgtaagtttatgatgtc |
33213251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University