View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17380_high_57 (Length: 245)
Name: NF17380_high_57
Description: NF17380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17380_high_57 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 103 - 226
Target Start/End: Complemental strand, 37858927 - 37858804
Alignment:
| Q |
103 |
tgtgttgagaaggtggaagatgagatgggtgtgactaagtttggaagaccaagaaggtgcaaagaaagtgggaatagagannnnnnnggtgatggatact |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37858927 |
tgtgttgagaaggtggaagatgagatgggtgtgactaagtttggaagaccaagaaggtgcaaagaaagtgggaatagagatttttttggtgatggatact |
37858828 |
T |
 |
| Q |
203 |
ttgagcttccatctctttcactat |
226 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37858827 |
ttgagcttccatctctttcactat |
37858804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University