View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17380_high_60 (Length: 238)
Name: NF17380_high_60
Description: NF17380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17380_high_60 |
 | |
|
| [»] chr1 (4 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 47575374 - 47575153
Alignment:
| Q |
17 |
attatctagtgcgatgttggggggcatattgtcttcagttccattacgcttaaaatatggtggttcaagaggggatggcaagttggttgaagaactgttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47575374 |
attatctagtgcgatgttggggggcatattgtcttcagttccattacgcttaaaatatggtggttcaagaggggatggcaagttggttgaagaactgttg |
47575275 |
T |
|
| Q |
117 |
aggtagaatgcaactgttgccattgtaggcctgtcttctggattttcctgaacacataacaaaccaatgtggatgtagttgatgacttcttcatgggaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47575274 |
aggtagaatgcaactgttgccattgtaggcctgtcttctggattttcctgaacacataacaaaccaatgtggatgtagttgatgacttcttcatgggaat |
47575175 |
T |
|
| Q |
217 |
aagttccttctatattaggatc |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
47575174 |
aagttccttctatattaggatc |
47575153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 48 - 226
Target Start/End: Complemental strand, 47585031 - 47584853
Alignment:
| Q |
48 |
tcttcagttccattacgcttaaaatatggtggttcaagaggggatggcaagttggttgaagaactgttgaggtagaatgcaactgttgccattgtaggcc |
147 |
Q |
| |
|
|||||| |||| |||||| ||||||||||||||||||||||||||||| |||| |||||| ||||||||||||||||| | ||||||||||||||| | |
|
|
| T |
47585031 |
tcttcatttcctctacgctgaaaatatggtggttcaagaggggatggcaggttgattgaagggctgttgaggtagaatgctattgttgccattgtaggtc |
47584932 |
T |
|
| Q |
148 |
tgtcttctggattttcctgaacacataacaaaccaatgtggatgtagttgatgacttcttcatgggaataagttccttc |
226 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
47584931 |
tgtcatctggattttcttgaacacataacaaaccaatgtggatgtatttgatgacttcttcatgtgaataagttccttc |
47584853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 191
Target Start/End: Complemental strand, 47637172 - 47637110
Alignment:
| Q |
129 |
actgttgccattgtaggcctgtcttctggattttcctgaacacataacaaaccaatgtggatg |
191 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||| || ||||||| |||||||| |||||| |
|
|
| T |
47637172 |
actgttgccattgtaggtctatcttctggatcttcttggacacatagtaaaccaatatggatg |
47637110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 127 - 184
Target Start/End: Complemental strand, 47594033 - 47593976
Alignment:
| Q |
127 |
caactgttgccattgtaggcctgtcttctggattttcctgaacacataacaaaccaat |
184 |
Q |
| |
|
|||| |||||||||||||| || | | ||||||||| |||||||||||||||||||| |
|
|
| T |
47594033 |
caaccgttgccattgtaggtcttacatttggattttcttgaacacataacaaaccaat |
47593976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University