View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17380_high_61 (Length: 236)
Name: NF17380_high_61
Description: NF17380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17380_high_61 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 8 - 222
Target Start/End: Complemental strand, 12221073 - 12220862
Alignment:
| Q |
8 |
tatcttttacgtgtagttttgtgcttctaagcttggttcctagattagatttagatgtactatcattgttattacttaggctatgtagggagtannnnnn |
107 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||||||||||||| | ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12221073 |
tatcttttgcgtgtagttttgtgcttctaagcttggttcgtagattagatttaggtttactatcattgttattacttaggttatgtagggagtatttttt |
12220974 |
T |
|
| Q |
108 |
nnnnnnnnnnaagaaatgatgttaactaaacatgggtagctttacacatatttttatcgttggataagtaagaatttccattcgttttgaaccaaaaatg |
207 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12220973 |
ttttatta--aagaaatgatgttaactaa-catgggtagctttacacatctttttatcgttggataagtaagaatttccattcgttttgaaccaaaaatg |
12220877 |
T |
|
| Q |
208 |
attgtagatatttct |
222 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
12220876 |
attgttgatatttct |
12220862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University