View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17380_high_9 (Length: 581)
Name: NF17380_high_9
Description: NF17380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17380_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 326; Significance: 0; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 225 - 554
Target Start/End: Original strand, 29870852 - 29871181
Alignment:
| Q |
225 |
cctacaactcaaattctccctctgcactcgatcatttcacctcagaaaacgaaactacaactgaattagggttttgttgccaaacgatgggaacaagatc |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29870852 |
cctacaactcaaattctccctctgcactcgatcatttcacctcagaaaacgaaactacaactgaattagggttttgttgccaaacgatgggaacaagatc |
29870951 |
T |
 |
| Q |
325 |
gcagcaatcgtgtgtcgacgaagatgaggaggaatttatcggttgtggaactacgatttcgggacaatcaggctcaaccagcaggagtgccggcgggtta |
424 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29870952 |
gcagcaatcgtgtgtcgacgaagatgaggaggaatttatcggttgtggaactacgatttcgggacaatcaggctcaaccagcaggagtgccggcgggtta |
29871051 |
T |
 |
| Q |
425 |
gcgtctagccgaagcgagcagacgattgggacagccgccggtgataacactgctctcagattgaatcatcttgatatacaggatgatgatgctgcttccc |
524 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29871052 |
gcgtctagccgaagcgagcagacgattgggacagccgccggtgataacactgctctcagattgaatcatcttgatatacaggatgatgatgctgcttccc |
29871151 |
T |
 |
| Q |
525 |
aaggagtggttgcgtaagttctattgcatt |
554 |
Q |
| |
|
||||||| |||||||||||||||||||||| |
|
|
| T |
29871152 |
aaggagtagttgcgtaagttctattgcatt |
29871181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 16 - 167
Target Start/End: Original strand, 29870643 - 29870794
Alignment:
| Q |
16 |
cactttaaaccttgcgtagggatagtagggattggagaatttaggagtaccgcattcgtatttcgtgctgctactcaacaaacaaaccccgttctcccct |
115 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29870643 |
cactttaaaccttgagtagggatactagggattggagaatttaggagtaccgcattcgtatttcgtgctgctactcaacaaacaaaccccgctctcccct |
29870742 |
T |
 |
| Q |
116 |
caatcagatctactttttccctcaccggtaaccaccagccctcaccgccgta |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29870743 |
caatcagatctactttttccctcaccggtaaccaccatccctcaccgccgta |
29870794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 122; E-Value: 3e-62
Query Start/End: Original strand, 324 - 519
Target Start/End: Original strand, 29865403 - 29865595
Alignment:
| Q |
324 |
cgcagcaatcgtgtgtcgacgaagatgaggaggaatttatcggttgtggaactacgatttcgggacaatcaggctcaaccagcaggagtgccggcgggtt |
423 |
Q |
| |
|
|||| ||||||| ||| |||||||| || |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29865403 |
cgcatcaatcgtctgtggacgaagaggatgaggaattgatgggttgtggaactacgatttcgggacaatcaggctcaaccagcaggagtgccgg---gtt |
29865499 |
T |
 |
| Q |
424 |
agcgtctagccgaagcgagcagacgattgggacagccgccggtgataacactgctctcagattgaatcatcttgatatacaggatgatgatgctgc |
519 |
Q |
| |
|
| |||||||||| || |||||||| | ||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29865500 |
accgtctagccggagtgagcagaccacggggacagccgccggtgataacgctgctctcaaattgaatcatcttgatatacaggatgatgatgctgc |
29865595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University