View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17380_low_27 (Length: 424)
Name: NF17380_low_27
Description: NF17380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17380_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 26 - 200
Target Start/End: Complemental strand, 33213767 - 33213593
Alignment:
| Q |
26 |
gttaagcaaggaatcgtaggaaagtgattgaacaaacagtgtcttttgaaaagccaaattttcatgcggttgggaaaatactgacaacaaagaaaaatta |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33213767 |
gttaagcaaggaatcgtaggaaagtgattgaacaaacagtgtcttttgaaaagccaaattttcatgcggttgggaaaatactgacaacaaagaaaaatta |
33213668 |
T |
 |
| Q |
126 |
tttttaccaacaaaaaagattgtcgtagatttattattagctcttcgtacgttggttttgtttggactcattggg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33213667 |
tttttaccaacaaaaaagattgtcgtagatttattattagctcttcgtacgttggttttgtttggactcattggg |
33213593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 316 - 411
Target Start/End: Complemental strand, 33213477 - 33213385
Alignment:
| Q |
316 |
tttggggagtgaaaaggatatgacacttgaactcgtgtttgtagtacttcatggcatgtagtattattggtttgtacatccctaactcattcatct |
411 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33213477 |
tttggggagtgaaaaggatatgacacttgaactcgtgtttgta---cttcatggcatgtagtattattggtttgtatatccctaactcattcatct |
33213385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University