View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17380_low_27 (Length: 424)

Name: NF17380_low_27
Description: NF17380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17380_low_27
NF17380_low_27
[»] chr6 (2 HSPs)
chr6 (26-200)||(33213593-33213767)
chr6 (316-411)||(33213385-33213477)


Alignment Details
Target: chr6 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 26 - 200
Target Start/End: Complemental strand, 33213767 - 33213593
Alignment:
26 gttaagcaaggaatcgtaggaaagtgattgaacaaacagtgtcttttgaaaagccaaattttcatgcggttgggaaaatactgacaacaaagaaaaatta 125  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33213767 gttaagcaaggaatcgtaggaaagtgattgaacaaacagtgtcttttgaaaagccaaattttcatgcggttgggaaaatactgacaacaaagaaaaatta 33213668  T
126 tttttaccaacaaaaaagattgtcgtagatttattattagctcttcgtacgttggttttgtttggactcattggg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33213667 tttttaccaacaaaaaagattgtcgtagatttattattagctcttcgtacgttggttttgtttggactcattggg 33213593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 316 - 411
Target Start/End: Complemental strand, 33213477 - 33213385
Alignment:
316 tttggggagtgaaaaggatatgacacttgaactcgtgtttgtagtacttcatggcatgtagtattattggtttgtacatccctaactcattcatct 411  Q
    |||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||| |||||||||||||||||||    
33213477 tttggggagtgaaaaggatatgacacttgaactcgtgtttgta---cttcatggcatgtagtattattggtttgtatatccctaactcattcatct 33213385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University