View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17380_low_34 (Length: 403)
Name: NF17380_low_34
Description: NF17380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17380_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 10 - 234
Target Start/End: Original strand, 38699600 - 38699824
Alignment:
| Q |
10 |
attattcttgatctgaactcaactttcaaggtattttcatcgtcctgctgaattannnnnnnccgattggtttcggcgtttgttacatcacaaatattgc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
38699600 |
attattcttgatctgaactcaactttcaaggtattttcatcgtcctgctgaattatttttttccgattggtttcggcttttgttgcatcacaaatattgc |
38699699 |
T |
|
| Q |
110 |
tctacagataatcttagtttgccagtttgactatatatgatcccttgggttcttcacacttgtttaggattctcgactctcgttgctttcttgctgaatc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38699700 |
tctacagataatcttagtttgccagtttgactatatatgatcccttgggttcttcacacttgtttaggattctcgactctcgtcgctttcttgctgaatc |
38699799 |
T |
|
| Q |
210 |
cctaattttcgcagttcgacgtaac |
234 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38699800 |
cctaattttcgcagttcgacgtaac |
38699824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 319 - 385
Target Start/End: Original strand, 38699909 - 38699975
Alignment:
| Q |
319 |
ggcaggtatatgttttgactaaagtcatggtttatctattgtagtcttggaaggtatggtgcttttt |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38699909 |
ggcaggtatatgttttgactaaagtcatggtttatctattgtagtcttggaaggtatggtgcttttt |
38699975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University