View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17380_low_55 (Length: 269)
Name: NF17380_low_55
Description: NF17380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17380_low_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 10 - 254
Target Start/End: Original strand, 43035669 - 43035911
Alignment:
| Q |
10 |
tatactacactatagagtgaagaaagaagaagcatata-tataatagaacagaataggttgaattggttttgcagcttgacttcttctactactgtccgg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43035669 |
tatactacactatagagtgaagaaagaagaagcatataatagaatagaacagaacaggttgaattggttttgcagcttgacttc---tactactgtccgg |
43035765 |
T |
 |
| Q |
109 |
ttgttcattcaaagagattatgagtcgttacgatagccgttcctccgaccccacttcctaccgcgaccgtagaaggtaactctaacctctctccaatttc |
208 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43035766 |
ttgttcattcaaagagatcatgagtcgttacgatagccgttcctccgaccccacttcctaccgcgaccgtagaaggtaactctaacctctctccaatttc |
43035865 |
T |
 |
| Q |
209 |
cactttctagggtttcattcaatgctcttttctatttcctaatttc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43035866 |
cactttctagggtttcattcaatgctcttttctatttcctaatttc |
43035911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University