View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17380_low_60 (Length: 249)
Name: NF17380_low_60
Description: NF17380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17380_low_60 |
 | |
|
| [»] scaffold0050 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0050 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 46885 - 46649
Alignment:
| Q |
13 |
aatatggtttacttggtttttaattttcatgatagtgttgcaaattattatatcattttctacctcactaaatcgggactccaactcacaagttagtaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46885 |
aatatggtttacttggtttttaattttcatgatagtgttgcaaattattatatcattttctacctcactaaatcgggactccaactcacaagttagtaaa |
46786 |
T |
|
| Q |
113 |
aaggaagagaattctaaagcttttattttatggaagagattgaaaactgatattgtgcatttagaacttggaggataaaaaacttaggattgggataaag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46785 |
aaggaagagaattctaaagcttttattttatggaagagattgaaaactgatattgtgcatttagaacttggaggataaaaaacttaggattgggataaag |
46686 |
T |
|
| Q |
213 |
tatcgtgaaatcaagagttgaaatgaatgaacactag |
249 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
46685 |
tatcatgaaatcaatagttgaaatgaatgaacactag |
46649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University