View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17380_low_62 (Length: 245)
Name: NF17380_low_62
Description: NF17380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17380_low_62 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 10479188 - 10478957
Alignment:
| Q |
1 |
aaatttcgtcataattttaagaagttttccacgaagggctgctgccttggtaaccttaatccactcataactacttaattatatggtgatgtttagtgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10479188 |
aaatttcgtcataattttaagaagttttccacgaagggctgccgccttggtaaccttaatccactcataactacttaattatatggtgatgtttagtgtg |
10479089 |
T |
|
| Q |
101 |
caaagtgtagcatttgcttgaatatatgccattatgtttc---tattgctaagtgccgcataatttttggtatgagatggtatccttttttcagcattta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10479088 |
caaagtgtagcatttgcttgaatatatgccatgatgtttctattattgctaagtgccgcataatttttggtatgagatggtatccttttttcagcattta |
10478989 |
T |
|
| Q |
198 |
cttttgtttacttcattaacttttgcttgaat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10478988 |
cttttgtttacttcattaacttttgcttgaat |
10478957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University