View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17380_low_63 (Length: 241)
Name: NF17380_low_63
Description: NF17380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17380_low_63 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 20 - 226
Target Start/End: Complemental strand, 47028048 - 47027843
Alignment:
| Q |
20 |
gctttatgtcttgcaggcttttaaagcacctgaaatgcnnnnnnnnnnnnnncatgtatattttttcctatcagaatatgaacattgtattgccaaagag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47028048 |
gctttatgtcttgcaggcttttaaagcacctgaaatgcaacaaaaaaaaaa-catgtatattttttcctatcagaatatgaacattgtattgccaaagag |
47027950 |
T |
 |
| Q |
120 |
ttttcaaaacatacagaaaattagacatgatattttgaagcttacccttctatgtttttctcctcacagtagtttttgaaggcaatacagactctctgaa |
219 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47027949 |
ttttcaaaacataaagaaaattagacatgatattttgaagcttacccttctatgtttttctcctcacagtagtttttgaaggcaatacagactctctgaa |
47027850 |
T |
 |
| Q |
220 |
ctctctg |
226 |
Q |
| |
|
||||||| |
|
|
| T |
47027849 |
ctctctg |
47027843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University