View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17380_low_67 (Length: 234)
Name: NF17380_low_67
Description: NF17380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17380_low_67 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 215
Target Start/End: Original strand, 20347800 - 20348002
Alignment:
| Q |
13 |
attatacttgaatataagataatcaaacttgaaacctttttcgaccatgttggacaataaggataataagctactatgtttcgtttggtatggttacctt |
112 |
Q |
| |
|
|||||| || ||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20347800 |
attatatttaaatatgagataattaaacttgaaacctttttcgaccatgttggacaataaggataataagctactatgtttcgtttggtatggttacctt |
20347899 |
T |
|
| Q |
113 |
gcggagactatcctaggtgtggatggtaaagtgtctagtttagctagtatcctattgttagtctggaatagtcaagctccttccaaagttcaagtgtttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20347900 |
gcggagactatcctaggtgtggatggtaaagtgtctagtttagctagtatcctattgttagtctggaatagtcaagctccttccaaagttcaagtgtttt |
20347999 |
T |
|
| Q |
213 |
tct |
215 |
Q |
| |
|
||| |
|
|
| T |
20348000 |
tct |
20348002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University