View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17380_low_69 (Length: 228)
Name: NF17380_low_69
Description: NF17380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17380_low_69 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 2e-54; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 33973161 - 33973272
Alignment:
| Q |
1 |
tctcacacatttagagagcaatattattatttacctgcaaattattccatgagacataaatttcatacacaaattttcctatggtttgatggcattgatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33973161 |
tctcacacatttagagagcaatattattatttacctgcaaattattccatgagacataaatttcatacacaaatttttctatggtttgatggcattgatg |
33973260 |
T |
 |
| Q |
101 |
tgataccaacat |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
33973261 |
tgataccaacat |
33973272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 113 - 217
Target Start/End: Original strand, 33973313 - 33973417
Alignment:
| Q |
113 |
cctaacggtaaaagttaatagaggggactatttttatggtcattttacgattttaaggatgtatttgccatttcataaattcaaggatcattttgaccta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| | |
|
|
| T |
33973313 |
cctaacggtaaaagttaatagaggggactatttttatggtcattttacgattttaaggatgtatttgtcatttcataaattcaatgatcattttgaccaa |
33973412 |
T |
 |
| Q |
213 |
tgctt |
217 |
Q |
| |
|
||||| |
|
|
| T |
33973413 |
tgctt |
33973417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 114 - 186
Target Start/End: Original strand, 33980778 - 33980849
Alignment:
| Q |
114 |
ctaacggtaaaagttaatagaggggactatttttatggtcattttacgattttaaggatgtatttgccatttc |
186 |
Q |
| |
|
||||| |||||| ||||| ||||| |||| | |||| |||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
33980778 |
ctaaccgtaaaacttaatggaggg-actaatgttatagtcattttacaattttaaggatgtatatgccatttc |
33980849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University