View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17380_low_73 (Length: 221)
Name: NF17380_low_73
Description: NF17380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17380_low_73 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 21 - 198
Target Start/End: Original strand, 53598584 - 53598761
Alignment:
| Q |
21 |
atactacaattgggaagtgttcatggaccaaaataatcgatccttacaattttaaaaaataattatgacacatcttatgattnnnnnnntaattattcgc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
53598584 |
atactacaattgggaagtgttcatggaccaaaataatcgatccttacaattttaaaaaataattatgacacatcttatgattaaaaaaataattattcgc |
53598683 |
T |
 |
| Q |
121 |
aaacgatctatttaattaaacaacaatggttnnnnnnnttatgacacatctttctgacacacaacttgcccaagatta |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53598684 |
aaacgatctatttaattaaacaacaatggttaaaaaaattatgacacatctttccgacacacaacttgcccaagatta |
53598761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University