View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17380_low_74 (Length: 209)
Name: NF17380_low_74
Description: NF17380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17380_low_74 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 21 - 200
Target Start/End: Complemental strand, 45633412 - 45633240
Alignment:
| Q |
21 |
ctattaccacctctaagcctgtccatgcaacatggagtattttacttaggattcagattctgcgttgacattcactgcagtcaaagaaacagccgccatt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45633412 |
ctattaccacctctaagcctgtccatgcaacatggagtatttta-------ttcagattctgcgttgacattcactgcagtcaaagaaacagccgccatt |
45633320 |
T |
 |
| Q |
121 |
gatatttccacgcagttttattaggtcaactctaacccccaaaatatttgtgatagtatactgtatatattcttggacat |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
45633319 |
gatatttccatgcagttttattaggtcaactctaacccccaaaatatttgtgatagtatactgtatatgttgttggacat |
45633240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University