View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17381_low_11 (Length: 233)
Name: NF17381_low_11
Description: NF17381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17381_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 15 - 219
Target Start/End: Complemental strand, 7865923 - 7865719
Alignment:
| Q |
15 |
aatattcagagctacttcaaaaatcagctccaattggagctaaaattggttttgcaaaaggtgcaggaatgggtgttatctacttagtaacatattcaac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7865923 |
aatattcagagctacttcaaaaatcagctccaattggagctaaaattggttttgcaaaaggtgcaggaatgggtgttatctacttagtaacatattcaac |
7865824 |
T |
 |
| Q |
115 |
atgggctttggctttttggtatggctctatcttaattgctaggggtgaacttgatggtggttcagctattgcttgtttctttggtgtcaatgttggggga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7865823 |
atgggctttggctttttggtatggctctatcttaattgctaggggtgaacttgatggtggttcagctattgcttgtttcttcggtgtcaatgttggggga |
7865724 |
T |
 |
| Q |
215 |
aggtg |
219 |
Q |
| |
|
||||| |
|
|
| T |
7865723 |
aggtg |
7865719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University