View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17381_low_6 (Length: 307)
Name: NF17381_low_6
Description: NF17381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17381_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 414524 - 414796
Alignment:
| Q |
1 |
gcgtcttgaagcttctgatgatgatcctcttgttaaacgtgttgcttctcagtttaaatctcgcaaaaacgatatcctcgttaaggtaattcatatttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
414524 |
gcgtcttgaagcttctgatgatgatcctcttgttaaacgtgttgcttctcagtttaaatctcgcaaaaacgatatcctcgttaaggtaattcatacttaa |
414623 |
T |
 |
| Q |
101 |
ttacttactaactcttctc-tttaatttcttaatttgtataactaacacctctgatcgaagttgtgtctagtgtctgacatgtgttagtgtgtgattcan |
199 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
414624 |
ttacttactaactcttctcttttaatttcttaatttgtataactaacacctctgatcgaagttgtgtctggtgtctgacatgtgttagtgtgtgattcat |
414723 |
T |
 |
| Q |
200 |
nnnnnnaaattattaccggtttgtgtgaacgtgttagtgtcagtgacttgtctctattggtgcttcatagttt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
414724 |
ttttttaaattattaccggtttgtgtgaacgtgttagtgtcagtgacttgtctctattggtgcttcatagttt |
414796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University