View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17381_low_8 (Length: 253)
Name: NF17381_low_8
Description: NF17381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17381_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 128 - 244
Target Start/End: Complemental strand, 41305138 - 41305021
Alignment:
| Q |
128 |
agcttttgcaacaaaccatcaaaaactggtgtggtgcaaatcggtttaactgaaccatttc-tttgctccaacctttaaattttatattagaaagtattt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41305138 |
agcttttgcaacaaaccatcaaaaactggtgtggtgcaaatcggtttaactgaaccatttcttttgctccaacctttaaattttatattagaaaatattt |
41305039 |
T |
|
| Q |
227 |
attttaagaaagtataat |
244 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
41305038 |
attttaagaaagtataat |
41305021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 17 - 72
Target Start/End: Complemental strand, 41305256 - 41305201
Alignment:
| Q |
17 |
attatgagaacaacttactatttcaaattaactttacctctctgtataacacacac |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41305256 |
attatgagaacaacttactatttcaaattaactttacctctctatataacacacac |
41305201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University