View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17382_high_7 (Length: 342)
Name: NF17382_high_7
Description: NF17382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17382_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 327
Target Start/End: Complemental strand, 34083976 - 34083650
Alignment:
| Q |
1 |
agtcacaatttaatagatttagagggcatttgtctatgtgattataagacaactataaggtggacgaatggtacgtattggtcaccattgaccgtatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34083976 |
agtcacaatttaatagatttagagggcatttgtctatgtcattataagacaactataaggtggacgaatggtacgtattggtcaccattgaccgtatttt |
34083877 |
T |
 |
| Q |
101 |
agcatctttattctatttaacattacaacgttgtttgatttttatagctgatattatgcattgtcaacacttgaacactcacacatctctccccatggtt |
200 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34083876 |
agcatctttattctatttaacattataatgttgtttgatttttatagctgatattatgcattgtcaacacttgaacactcacacatctctccccatggtt |
34083777 |
T |
 |
| Q |
201 |
gcaaaccataatctcgttgaatctgatgtagcacgcatgtttgcatctctaagacaaagtatggaacagggaatacctcttttgttgaggttttctgatc |
300 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34083776 |
gcaaaccttaatctcgttgaatctgatgtagcacgcatgtttgcatctctaagacaaagtatggaacagggaatacctcttttgttgaggttttctgatc |
34083677 |
T |
 |
| Q |
301 |
tagtagttaggaagagactgtacataa |
327 |
Q |
| |
|
||| ||||||||||||||||||||||| |
|
|
| T |
34083676 |
tagcagttaggaagagactgtacataa |
34083650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University