View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17382_low_14 (Length: 250)
Name: NF17382_low_14
Description: NF17382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17382_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 10 - 235
Target Start/End: Complemental strand, 34661476 - 34661255
Alignment:
| Q |
10 |
ataatactattatgggagtgtaactaattgggagtgcattgatatatatatgcagctaatgaggtatgtgatagatttgcggtgactggttttaatggta |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34661476 |
ataatactattatgggagtgtaactaattgggagtgcattgatatat----gcagctaatgaggtatgtgatagatttgcggtgactggttttaatggta |
34661381 |
T |
|
| Q |
110 |
acttgataagttacctaactcaagagttgaatatgccattggtatcagctgcaaacacactcacaatctttggtggaacagctagcttcacacctctcat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34661380 |
acttgataagttacctaactcaagagttgaatatgccattggtatcagctgcaaacacactcacaatctttggtggaacagctagcttcacacctctcat |
34661281 |
T |
|
| Q |
210 |
tggtgctctcatttcagagtcctttg |
235 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
34661280 |
tggtgctctcatttcagagtcctttg |
34661255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 59 - 212
Target Start/End: Complemental strand, 34647266 - 34647113
Alignment:
| Q |
59 |
atgcagctaatgaggtatgtgatagatttgcggtgactggttttaatggtaacttgataagttacctaactcaagagttgaatatgccattggtatcagc |
158 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||| |||| ||| | |||||||||||||||||||||| |||||||||||||||||||||||| | || |
|
|
| T |
34647266 |
atgcagcaaatgaagtatgtgatagatttgcgggcgctggatttcacagtaacttgataagttacctaacccaagagttgaatatgccattggtagctgc |
34647167 |
T |
|
| Q |
159 |
tgcaaacacactcacaatctttggtggaacagctagcttcacacctctcattgg |
212 |
Q |
| |
|
| |||| |||||||||| ||||||||||||| |||||||||| ||||| ||||| |
|
|
| T |
34647166 |
ttcaaatacactcacaaactttggtggaacatctagcttcacccctcttattgg |
34647113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University