View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17383_high_12 (Length: 235)
Name: NF17383_high_12
Description: NF17383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17383_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 15 - 228
Target Start/End: Complemental strand, 29180260 - 29180047
Alignment:
| Q |
15 |
acttgctcatattcatctgtatggaattgagcttggtcaaaacttatgtaagaatccattaatgctggaagtgatgaagagcctgtgtcatcatagcaac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29180260 |
acttgctcatattcatctgtatggaattgagcttggtcaaaacttatgtaagaatccattaatgctggaagtgatgaagagcctgtgtcatcatagcaac |
29180161 |
T |
 |
| Q |
115 |
tacccatgcttggaggttttgtagcaacttctctgtttttgtagaacactctacacaaaacccaatcttcctgtatatacacaagattatgcaaattatt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29180160 |
tacccatgcttggaggttttgtagcaacttctctgtttttgtagaacaccctacacaaaacccaatcttcctgtatatacacaagattatgcaaattatt |
29180061 |
T |
 |
| Q |
215 |
attactctattcat |
228 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
29180060 |
attactctattcat |
29180047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University