View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17383_high_15 (Length: 215)
Name: NF17383_high_15
Description: NF17383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17383_high_15 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 3 - 215
Target Start/End: Complemental strand, 31936246 - 31936034
Alignment:
| Q |
3 |
cattcgtgaacaaatgtgaccacacaatatggccaggaattctaggaaaaccagacctcggaacaaccggttttgaactcaaaaaaggaaatacacaaac |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31936246 |
cattcgtgaacaaatgtgaccacacaatatggccaggaattctaggaaaaccagacctcggaacaaccggttttgaactcaaaaaaggaaatacacaaac |
31936147 |
T |
|
| Q |
103 |
cttccaagcaccagccggttggtcaggtagattctgggcaagaaccggttgcaaattcgacgattctggtcacggaacttgctcaaccggtgactgtggt |
202 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31936146 |
cttccaagcactagccggttggtcaggtagattctgggcaagaaccggttgcaaattcgacgattctggtcacggaacttgctcaaccggtgactgtggt |
31936047 |
T |
|
| Q |
203 |
tccggagaaatta |
215 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31936046 |
tccggagaaatta |
31936034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 9 - 189
Target Start/End: Original strand, 8810164 - 8810344
Alignment:
| Q |
9 |
tgaacaaatgtgaccacacaatatggccaggaattctaggaaaaccagacctcggaacaaccggttttgaactcaaaaaaggaaatacacaaaccttcca |
108 |
Q |
| |
|
||||||| ||||| ||||| |||||||||||||| |||| ||| || || ||||| || ||||| || ||| |||||||| | | ||||||||| |
|
|
| T |
8810164 |
tgaacaagtgtgattacacagtatggccaggaatttatggaagaccggaacttggaactactggtttcgagctcgcaaaaggaacttccagaaccttcca |
8810263 |
T |
|
| Q |
109 |
agcaccagccggttggtcaggtagattctgggcaagaaccggttgcaaattcgacgattctggtcacggaacttgctcaac |
189 |
Q |
| |
|
||||||| |||| ||||||||||||||||||| ||||||||| ||| ||||||| || || || ||||||||||||||||| |
|
|
| T |
8810264 |
agcaccaaccggatggtcaggtagattctggggaagaaccggctgccaattcgatgactccggccacggaacttgctcaac |
8810344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 47
Target Start/End: Complemental strand, 27975975 - 27975931
Alignment:
| Q |
3 |
cattcgtgaacaaatgtgaccacacaatatggccaggaattctag |
47 |
Q |
| |
|
|||| ||||||||||||||| ||||| |||||||||| ||||||| |
|
|
| T |
27975975 |
catttgtgaacaaatgtgactacacagtatggccaggtattctag |
27975931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University