View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17383_low_4 (Length: 402)
Name: NF17383_low_4
Description: NF17383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17383_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 15 - 385
Target Start/End: Complemental strand, 23674555 - 23674185
Alignment:
| Q |
15 |
aatactatcagcagattcatgcagtaataacttcatttgaatatgttgccggccttggtaacgcagctccgtatgcaagtttggctataaatgccatgtc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23674555 |
aatactatcagcagattcatgcagtaataacttcatttgaatatgttgccggcctcggtaacgcagctccgtatgcaagtttggctataaatgccatgtc |
23674456 |
T |
|
| Q |
115 |
caaacattttagattcttgaagaatgtgattaccgaccaacttcagtttatcggtaagtctaattatcagataagcaatagaaaggatgaatctccaagg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
23674455 |
caaacattttagattcttgaagaatgtgattaccgaccagcttcagtttatcggtaagtctaattatcatataagcaatagaaaggatgaatctcccagg |
23674356 |
T |
|
| Q |
215 |
tttcacaatggcgatgaagccccttacagtcaaaggccagggtttgtagaacatgtccaacaatctgtttggcgacctcaaagagggttgcccgagcgtg |
314 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| ||||||||| | ||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23674355 |
tttcacaacggcgatggagccccttacagtcaaagtccagggtttatggaacacgtccaacaacctgtttggcgacctcaaagagggttgcccgagcgtg |
23674256 |
T |
|
| Q |
315 |
ctgtcagtgttcttaggggatggttgtttgaacactttttgcatccgtaagtgtgttatttcagtcttatt |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23674255 |
ctgtcagtgttcttaggggatggttgtttgaacactttttgcatccgtaagtgtgttatttcagtcttatt |
23674185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 272 - 367
Target Start/End: Complemental strand, 6085457 - 6085362
Alignment:
| Q |
272 |
caacaatctgtttggcgacctcaaagagggttgcccgagcgtgctgtcagtgttcttaggggatggttgtttgaacactttttgcatccgtaagtg |
367 |
Q |
| |
|
|||||| |||| ||||||||||||||||| | |||||||||||||| | ||||||||| | ||| | |||||||||||| |||||||||||||| |
|
|
| T |
6085457 |
caacaacctgtatggcgacctcaaagaggactccccgagcgtgctgtgactgttcttagagcctggctctttgaacactttctgcatccgtaagtg |
6085362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 77 - 138
Target Start/End: Complemental strand, 6085652 - 6085591
Alignment:
| Q |
77 |
gcagctccgtatgcaagtttggctataaatgccatgtccaaacattttagattcttgaagaa |
138 |
Q |
| |
|
|||||||| |||||||||||||| ||||| || ||||||||||||||||||| ||||||||| |
|
|
| T |
6085652 |
gcagctccttatgcaagtttggcgataaaagctatgtccaaacattttagatgcttgaagaa |
6085591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University