View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17383_low_9 (Length: 325)
Name: NF17383_low_9
Description: NF17383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17383_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 34 - 226
Target Start/End: Complemental strand, 6419145 - 6418953
Alignment:
| Q |
34 |
atccataacatgtgggtttggatttaatgggtctatccgagataatttgtgaacaacctcattcacttgtctcatgttgaactcgatacgagagttctga |
133 |
Q |
| |
|
|||||| ||||||| |||||||||||||| |||||| ||||||| | ||||||| |||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
6419145 |
atccatgacatgtgagtttggatttaatgaatctatctgagataactcgtgaacagcctcattcacttgtctcatgttgaactcaacacgagagttctga |
6419046 |
T |
 |
| Q |
134 |
aaactagtagctaacagtcgtgtgccaaacatatatgatataatcaaattcactactatcaactaaacatgttaaaatcaattttgacttatt |
226 |
Q |
| |
|
||||||||| |||||| ||||||||||| ||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6419045 |
aaactagtaactaacaatcgtgtgccaagcatatatgatacaatcaaattcactactatcaattaaacatgttaaaatcaattttgacttatt |
6418953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 53 - 135
Target Start/End: Original strand, 1479255 - 1479337
Alignment:
| Q |
53 |
ggatttaatgggtctatccgagataatttgtgaacaacctcattcacttgtctcatgttgaactcgatacgagagttctgaaa |
135 |
Q |
| |
|
|||||||||||| || |||||| ||| |||||| ||| |||| ||||| ||| | |||||||||||| ||||||||||||| |
|
|
| T |
1479255 |
ggatttaatggggctgtccgagctaacttgtgagtgaccccatttacttgcctcctattgaactcgatatgagagttctgaaa |
1479337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University