View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17383_low_9 (Length: 325)

Name: NF17383_low_9
Description: NF17383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17383_low_9
NF17383_low_9
[»] chr5 (1 HSPs)
chr5 (34-226)||(6418953-6419145)
[»] chr4 (1 HSPs)
chr4 (53-135)||(1479255-1479337)


Alignment Details
Target: chr5 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 34 - 226
Target Start/End: Complemental strand, 6419145 - 6418953
Alignment:
34 atccataacatgtgggtttggatttaatgggtctatccgagataatttgtgaacaacctcattcacttgtctcatgttgaactcgatacgagagttctga 133  Q
    |||||| ||||||| ||||||||||||||  |||||| ||||||| | ||||||| |||||||||||||||||||||||||||| | |||||||||||||    
6419145 atccatgacatgtgagtttggatttaatgaatctatctgagataactcgtgaacagcctcattcacttgtctcatgttgaactcaacacgagagttctga 6419046  T
134 aaactagtagctaacagtcgtgtgccaaacatatatgatataatcaaattcactactatcaactaaacatgttaaaatcaattttgacttatt 226  Q
    ||||||||| |||||| ||||||||||| ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||    
6419045 aaactagtaactaacaatcgtgtgccaagcatatatgatacaatcaaattcactactatcaattaaacatgttaaaatcaattttgacttatt 6418953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 53 - 135
Target Start/End: Original strand, 1479255 - 1479337
Alignment:
53 ggatttaatgggtctatccgagataatttgtgaacaacctcattcacttgtctcatgttgaactcgatacgagagttctgaaa 135  Q
    |||||||||||| || |||||| ||| ||||||   ||| |||| ||||| ||| | |||||||||||| |||||||||||||    
1479255 ggatttaatggggctgtccgagctaacttgtgagtgaccccatttacttgcctcctattgaactcgatatgagagttctgaaa 1479337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University