View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17384_high_6 (Length: 336)
Name: NF17384_high_6
Description: NF17384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17384_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 36864710 - 36864951
Alignment:
| Q |
1 |
cctttggagattcatcaaaatatttcgacaaagctccatccctcaaatttagaatttctttaaaatctgtcatagtcttctcccttccttcctttgcaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36864710 |
cctttggagattcatcaaaatatttcgacaaagctccatccctcaaatttagaatttctttaaaatctgtcatagtcttctcccttccttcctttgcaag |
36864809 |
T |
 |
| Q |
101 |
ttgaagttccttctccaaatggtcaattttaatgtcaaaatcctgcttgtctttcaagagttcctcgcagcgttttttcagcagctttcttctcatcaat |
200 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36864810 |
ttgaagttccttctccaaatgttctattttaatgtcaaaatcctgcttgtctttcaagagttcctcgcagcg-tttttcagcagctttcttctcatcaat |
36864908 |
T |
 |
| Q |
201 |
gagtgatctgagcatttgaaaaattgtgtcgtgctcttgttgg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36864909 |
gagtgatctgagcatttgaaaaattgtgtcgtgctcttgttgg |
36864951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 268 - 296
Target Start/End: Original strand, 36864948 - 36864976
Alignment:
| Q |
268 |
ttggtgataaaagggatgtcaatacgaag |
296 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36864948 |
ttggtgataaaagggatgtcaatacgaag |
36864976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University