View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17385_high_48 (Length: 257)
Name: NF17385_high_48
Description: NF17385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17385_high_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 15 - 217
Target Start/End: Original strand, 39482960 - 39483162
Alignment:
| Q |
15 |
aagatccactatccaatagaaacaaaacaatgacaacaaagcgagcacttcaacgtagataccataaatctcatcttgttccatataccgaacatttatc |
114 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39482960 |
aagatccactatccaataggaacaaaacaatgacaacaaagcgagcacttcaacgtagataccataaatctcatcttgttccatataccgaacatttctc |
39483059 |
T |
 |
| Q |
115 |
gtgtcccaccaaacactccttatcaccctcaaacgctgtcgtttaaatcattcaaacaatttcacaaatnnnnnnnccacaatcaatcagattccgattc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39483060 |
gtgtcccaccaaacactccttatcaccctcaaacgctgtcgtttaaatcattcaaacaatttcacaaataaaaaaaccacaatcaatcagattccgattc |
39483159 |
T |
 |
| Q |
215 |
ttc |
217 |
Q |
| |
|
||| |
|
|
| T |
39483160 |
ttc |
39483162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University