View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17385_high_51 (Length: 249)
Name: NF17385_high_51
Description: NF17385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17385_high_51 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 100 - 234
Target Start/End: Complemental strand, 15098070 - 15097936
Alignment:
| Q |
100 |
gcagcagaagaacacatatttgtcaacaaatatgagaaaagatgataaagaccatgatttcttttctcacaaattccctacaacctctcaggtaatacaa |
199 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15098070 |
gcagctgaagaacacatatttgtcaacaaatatgagagaagatgataaagaccatgatttcttttctcacaaattccctacaacctctcaggtaatacaa |
15097971 |
T |
|
| Q |
200 |
aaaactttatataatcacatttttgtgtttcaact |
234 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||| |
|
|
| T |
15097970 |
aaaactttgtacaatcacatttttgtgtttcaact |
15097936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 15098175 - 15098140
Alignment:
| Q |
1 |
atgtatgattgattatattgaaacaaacaaagtaga |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
15098175 |
atgtatgattgattatattgaaacaaacaaagtaga |
15098140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University