View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17385_high_55 (Length: 245)
Name: NF17385_high_55
Description: NF17385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17385_high_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 3548746 - 3548983
Alignment:
| Q |
1 |
tttagttcatcacattcttcttatatctgactcaacattgtctttgattaatagattatgacaacgcgacaacggactgatctccacatgaacatccctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3548746 |
tttagttcatcacattcttcttatatctgactcaacattgtctttgattaatagattatgacaacgcgacaacggactgatctccacatgaacatccctg |
3548845 |
T |
|
| Q |
101 |
ccttgagaaagcttgatgcaatgcttattgtaagatcacaaatcctgagttaaatatgatcattatatgttgggttaaatatgtttttagtcttgataat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3548846 |
ccttgagaaagcttgatgcaatgcttattgtaagatcacaaatcctgagttaaatatgatcattatatgttgggttaaatatgtttttagtcttgataat |
3548945 |
T |
|
| Q |
201 |
tatgccgaattttgtttttagtccctgcattcatttct |
238 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
3548946 |
tatgccgaattttgtttttagtccctgtattcacttct |
3548983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 226
Target Start/End: Complemental strand, 1829395 - 1829339
Alignment:
| Q |
170 |
ttgggttaaatatgtttttagtcttgataattatgccgaattttgtttttagtccct |
226 |
Q |
| |
|
||||||||||||||||||| ||||| |||| |||||| | |||| ||||||||||| |
|
|
| T |
1829395 |
ttgggttaaatatgtttttggtctttataaatatgccaactttttgttttagtccct |
1829339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 208 - 236
Target Start/End: Complemental strand, 20950923 - 20950895
Alignment:
| Q |
208 |
aattttgtttttagtccctgcattcattt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20950923 |
aattttgtttttagtccctgcattcattt |
20950895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 50 - 125
Target Start/End: Complemental strand, 43812326 - 43812251
Alignment:
| Q |
50 |
aatagattatgacaacgcgacaacggactgatctccacatgaacatccctgccttgagaaagcttgatgcaatgct |
125 |
Q |
| |
|
|||||||||||||||| |||||||| || |||||||||||||| ||||| ||||| | ||||| ||||||||||| |
|
|
| T |
43812326 |
aatagattatgacaacacgacaacgaacagatctccacatgaatatcccagccttacgcaagctcgatgcaatgct |
43812251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University