View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17385_high_64 (Length: 210)
Name: NF17385_high_64
Description: NF17385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17385_high_64 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 15 - 195
Target Start/End: Original strand, 34977941 - 34978125
Alignment:
| Q |
15 |
cataggtttgtgaaaataatgatgaaaccagttttatttcccacatatttttgctatatatgatgtgcatcacatgcttgtgcaaaatttgaattcgggg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34977941 |
cataggtttgtgaaaataatgatgaaaccagtttcatttcccacatatttttgctatatatgatgtgcatcacatgcttgtgcaaaatttgaattcgggg |
34978040 |
T |
|
| Q |
115 |
tgagatatttagaacctagtcacacgattttggttaaagt----tatatttggaagttttaataaattatggtgtcgtggtgatt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |||| |||||| |
|
|
| T |
34978041 |
tgagatatttagaacctagtcacacgattttggttaaagttatatatatttggaagttttgataaattatggtatcgtagtgatt |
34978125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University