View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17385_low_14 (Length: 493)
Name: NF17385_low_14
Description: NF17385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17385_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 63 - 329
Target Start/End: Complemental strand, 43102875 - 43102613
Alignment:
| Q |
63 |
acaacgtttgcatccacgagagctcccatacacactcatcttcctcccagtactgtccaatctcccata---ccctaccattttgctgctatgaaacctt |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43102875 |
acaacgtttgcatccacgagagctcccatacacactcatcttcctcccagt---gtccaatctcccataataccctaccattttgctgctatgaaacctt |
43102779 |
T |
 |
| Q |
160 |
aaatagtctttgatagtcaacctatcctcagtggcacacaaccaagtggaagatatgtatggatgataaccaaatttaggaggaccgccctacctcccaa |
259 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102778 |
aaatagtctttgatagccaacctatcctcagtggcacacaaccaagtggaagatatgtatggatgataaccaaatttaggaggaccgccctacctcccaa |
43102679 |
T |
 |
| Q |
260 |
gttgatatatttatttcctcaagaccccatatatagtcctttatataatatcaataagaggctgccaagt |
329 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102678 |
gttgatatatttatttcctcaagacccc----atagtcctttatataatatcaataagaggctgccaagt |
43102613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 338 - 403
Target Start/End: Complemental strand, 43102542 - 43102477
Alignment:
| Q |
338 |
taaagaaaacgcttagcgatacccaggaaatcatcattaaaataaacacacataacattaatctta |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102542 |
taaagaaaacgcttagcgatacccaggaaatcatcattaaaataaacacacataacattaatctta |
43102477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 445 - 476
Target Start/End: Complemental strand, 43102469 - 43102438
Alignment:
| Q |
445 |
atcctcaatttctttcttctttcacttctttt |
476 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43102469 |
atcctcaatttctttcttctttcacttctttt |
43102438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University