View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17385_low_28 (Length: 389)
Name: NF17385_low_28
Description: NF17385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17385_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 4e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 230 - 370
Target Start/End: Complemental strand, 28637254 - 28637115
Alignment:
| Q |
230 |
atgaacaatttactttacttgatgaattatgtaaactcaattgttaatggataaatcagcaaaagatatcacatctacaagaccttatatcagatatatt |
329 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28637254 |
atgaacaattcactt-acttgatgaattatgttaactcaattgttaatggataaatcagcaatagatatcacatctacaagaccttatatcagatatatt |
28637156 |
T |
|
| Q |
330 |
aagttttcaaccattttatcagctactgagaccttcttatt |
370 |
Q |
| |
|
|| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28637155 |
aaattttcaaccattttatcagctattgagaccttcttatt |
28637115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 84 - 187
Target Start/End: Complemental strand, 28637349 - 28637245
Alignment:
| Q |
84 |
atgtgggtggtttgcaaagtcaaattttcattatagcaaattatatcccccaa-aaaattgtttggggattatctatcaattacaaagttgtcaaatgaa |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28637349 |
atgtgggtggtttgcaaagtcaaattttcattatagcaaattattgcccccaaaaaaattgtttggggattatccatcaattacaaagttgtcaaatgaa |
28637250 |
T |
|
| Q |
183 |
aaatt |
187 |
Q |
| |
|
|||| |
|
|
| T |
28637249 |
caatt |
28637245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University