View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17385_low_30 (Length: 381)
Name: NF17385_low_30
Description: NF17385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17385_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 16 - 334
Target Start/End: Original strand, 9745394 - 9745712
Alignment:
| Q |
16 |
cttatcatatactagcatcatataattttattcagccgatctttagattccattaagattagggatatgatccctccaatattaatcagaaattagagat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9745394 |
cttatcatatactagcatcatataattttattcagccgatctttagattccattaagattagggatatgatccctccaatattaatcagaaattagagat |
9745493 |
T |
 |
| Q |
116 |
tggatcatttggtaacaattgtttttgtttaattagctatataatgttgtcctatgacatgacttgacttaacataaatgattccattccctattgatta |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9745494 |
tggatcatttggtaacaattttttttgtttaattagctatataatgttgtcctatgacatgacttgacttaacataaatgattccattccctattgatta |
9745593 |
T |
 |
| Q |
216 |
gttttaaaattttggcataaagctagtatctttgtagaatcttgtcaaattcctccgaccattactttggattgggttatttatgaaaccctttttcctt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9745594 |
gttttaaaattttggcataaagctagtatctttgtagaatcttgtcaaattcctccgaccattactttggattggattatttatgaaaccctttttcctt |
9745693 |
T |
 |
| Q |
316 |
ctctctcatatttataact |
334 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
9745694 |
ctctctcatctttataact |
9745712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University