View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17385_low_39 (Length: 304)
Name: NF17385_low_39
Description: NF17385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17385_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 18 - 294
Target Start/End: Original strand, 6801319 - 6801595
Alignment:
| Q |
18 |
acatcgaattcacgcaaacacttcagatactcaaccattcgatgacgattcgtcttctcactcaagtaattctctttctctctttctacgattcttcgat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6801319 |
acatcgaattcacgcaaacacttcagatactcaaccattcgatgacgattcctcttctcactcaagtaattctctttctctctctctacgattcttcgat |
6801418 |
T |
 |
| Q |
118 |
ctatcttttaacctaatccttcaattttacttcaannnnnnnnnnnnaactgatttaatcttaggtcaatacgaggatgacaaagaaaatcgattctttg |
217 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6801419 |
ctatcttttaacataatccttcaattttacttcaatttttgttttttaactgatttaatcttaggtcaatacgaggatgacaaagaaaatcgattctttg |
6801518 |
T |
 |
| Q |
218 |
aagatacggtgccgtttgatgacgatgaaactcaggcggtggatcttggtgatgaaactgaagtgtttgatgatatt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6801519 |
aagatacggtgccgtttgatgacgatgaaactcaggcggtggatcttggtgatgaaactgaagtgtttgatgatatt |
6801595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University