View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17385_low_44 (Length: 272)
Name: NF17385_low_44
Description: NF17385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17385_low_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 32 - 231
Target Start/End: Complemental strand, 42177471 - 42177263
Alignment:
| Q |
32 |
tttacaaagtgttgtttctcattggacataatcatagatatgt-------ggctaataaatatgtagtttcttcagcaaaaaatcttttttcttcaaaat |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42177471 |
tttacaaagtgttgtttctcattggacataatcatatatatgtaatatgtggctaataaatatgtagtttcttcagcaaaaaatcttttttcttcaaaat |
42177372 |
T |
 |
| Q |
125 |
gttgtttatcaacatatggaagtattgtaaatctcgagtggatagcatggaagtattgttcatttaattcaacattaaggtttcaatac--gtaaggtag |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
42177371 |
gttgtttatcaacatatggaagtattgtaaatctcgagtggatagcatggaagtattgttcatttaattcaacattaaggtttcaatacatgtaaggttg |
42177272 |
T |
 |
| Q |
223 |
ctcacaccc |
231 |
Q |
| |
|
||||||||| |
|
|
| T |
42177271 |
ctcacaccc |
42177263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 31 - 68
Target Start/End: Complemental strand, 42177515 - 42177478
Alignment:
| Q |
31 |
gtttacaaagtgttgtttctcattggacataatcatag |
68 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
42177515 |
gtttacaaagtgttgtttctcattgaacattatcatag |
42177478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University