View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17385_low_45 (Length: 268)
Name: NF17385_low_45
Description: NF17385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17385_low_45 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 257
Target Start/End: Original strand, 36479759 - 36479998
Alignment:
| Q |
18 |
aatacatgaaacaacaaaatgtgtaggtccggtggtgcaaagaagacgtaactaatcaataatgaaacaaacatttgatgtgattggtgcctcaaagaga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36479759 |
aatacatgaaacaacaaaatgtgtaggtccggtggtgcaaagaagacgtaactaatcaacaatgaaacaaacatttgatgtgattggtgcctcaaagaga |
36479858 |
T |
|
| Q |
118 |
taaatcttcaatttcaagctcaacggttgttggatgcagttcaatccaaattcaacatccttaccaatacaactggccacttcatgaatccatgattatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36479859 |
taaatcttcaatttcaagctcaacggttgttggatgcagttcaatccaaattcaacatccttaccaatacaactggccacttcatgaatccatgattatg |
36479958 |
T |
|
| Q |
218 |
ccatagatgaaatccgtgaaaatggctatagcagtttcat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36479959 |
ccatagatgaaatccgtgaaaatggctatagcagtttcat |
36479998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University