View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17385_low_61 (Length: 235)
Name: NF17385_low_61
Description: NF17385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17385_low_61 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 54988962 - 54989181
Alignment:
| Q |
1 |
ccgtcgttattggatgtgagaacaatgattccgccgtaaacagcaccgatgaggttgctgttgatgacgcggcgttggctgagggcggtgaaggccaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54988962 |
ccgtcgttattggatgtgagaacaatgattccgccgtaaacagcaccgatgaggttgctgttgatgacgcggcgttggctgagggcggtgaaggccaatt |
54989061 |
T |
|
| Q |
101 |
gcatgtgatggaaactgcttcctacggtgatggggatggtatgcaagacgatgaagaaattgctgcagaggagaaggggactgatgttgatttagagccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54989062 |
gcatgtgatggaaactgcttcctacggtgatggggatggtatgcaagacgatgaagaaattgctgcagaggagaaggggactgatgttgatttagagccc |
54989161 |
T |
|
| Q |
201 |
gataatgtcgaagaggttca |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
54989162 |
gataatgtcgaagaggttca |
54989181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University