View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17385_low_62 (Length: 229)
Name: NF17385_low_62
Description: NF17385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17385_low_62 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 46 - 212
Target Start/End: Complemental strand, 37879744 - 37879578
Alignment:
| Q |
46 |
ttgacgatgtttggacggacatcgtcgctgatggtggtgcaaaccatcttcatcatcaacaacattatcatcatccttcttctgatgaaggtttttctgc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37879744 |
ttgacgatgtttggacggacatcgtcgctgatggtggtgcaaaccatcttcatcatcaacaacattatcatcatccttcttctgatgaaggtttttctgc |
37879645 |
T |
 |
| Q |
146 |
ttgcggtgccggtggtggtgatgaagttactcttgaagatttcttggtgaaagctggtgctgttcct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37879644 |
ttgcggtgccggtggtggtgatgaagttactcttgaagatttcttggtgaaagctggtgctgttcct |
37879578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University