View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17385_low_64 (Length: 217)
Name: NF17385_low_64
Description: NF17385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17385_low_64 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 4 - 202
Target Start/End: Complemental strand, 63212 - 63000
Alignment:
| Q |
4 |
ttttttgtctatctctaatgttctctttcatgctttcatattctttacatgtgttctaatggcattgaaatttcttctggagttgaaaaaca--aaaagt |
101 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || ||| |
|
|
| T |
63212 |
ttttttgtctatctctactgttctctttcatgctttcatattctttacatgtgttctaatggcattgaaatttcttctggaattgaaaaacaataatagt |
63113 |
T |
 |
| Q |
102 |
ttttgacgcccgtttgaa------------atcaactttggatcccaattccttcatcctcatcagaagactgcctcataaggagattgcagaaattata |
189 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
63112 |
ttttgacgcccgtttgaaatcaacatcgtcatcaactttggatcccaattccttcatcctcatcagaagactgcctcataaggagattgcagaaattata |
63013 |
T |
 |
| Q |
190 |
attactatcattt |
202 |
Q |
| |
|
||||||||||||| |
|
|
| T |
63012 |
attactatcattt |
63000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University